Haplogroup I (Y-DNA): Wikis

Advertisements
  
  

Note: Many of our articles have direct quotes from sources you can cite, within the Wikipedia article! This article doesn't yet, but we're working on it! See more info or our list of citable articles.

Encyclopedia

From Wikipedia, the free encyclopedia

Haplogroup I

Haplogroup IJ (Y-DNA).jpg

Time of origin 25,000-30,000 years BP
Place of origin Europe or Asia Minor
Ancestor IJ
Descendants I1, I2
Defining mutations M170, M258, P19, P38, P212, U179
Highest frequencies Croats 45% (North)- 74% (South)[1], Bosniaks 48%[1], Norwegians 40%[2][3], Sardinians 37%[4]-42%[2], Swedes 26% (North)[2]-50% (Gotland & Värmland)[5], Danes 39%[2][6], Germans 37.5%[7], Serbs 36% (Serbia[8], Bosnia[1]), Icelanders 33%, Finns 20% (Eastern)[9]-41% (Western)[9], Hungarians 11%[7]-28%[10], Macedonia 20%[7]-25%, Netherlands 25%, England +20%, Romanians/Moldovans 22%[2]-48% (Buhuşi & Piatra Neamţ)[11], Bulgaria +20%

In human genetics, Haplogroup I is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ, itself a derivative of Haplogroup IJK.

Y-DNA Haplogroup I (the letter I, not the number 1) represents nearly one-fifth of the population of Europe. It can be found in the majority of present-day European populations; the greatest density to be found in Bosnia and Herzegovina, Croatia, Norway, Sweden, Sardinia, Denmark, Serbia and Germany. The haplogroup is almost non-existent outside of Europe, suggesting that it arose in Europe.

Contents

Origins

European LGM refuges, 20 kya.
     Solutrean and Proto Solutrean Cultures     Epi Gravettian Culture

The TMRCA (time to most recent common ancestor) for the I clade, expressed in ky (confidence interval), is 22.2 (15.3-30.0)[12], placing the Haplogroup I founding event approximately contemporaneous with the onset of the last glacial maximum (LGM) approximately 21 thousand years ago. Some speculate the initial dispersion of this population corresponds to the diffusion of the Gravettian culture.[7]

Haplogroup I is closely related to Haplogroup J, which is today most common in Semitic and Northeast Caucasian peoples; both Haplogroup I and Haplogroup J have mutations in common making them descendants of Haplogroup IJ (S2, S22). The divergence of Haplogroup IJ into its descendant lineages, Haplogroups I and J, however, occurred many thousands of years prior to the first attestations of Semitic languages, peoples or cultures during the mid-third millennium B.C. Furthermore, the Semitic languages, and the larger Afro-Asiatic languages of which they form a part, are most strongly associated with the M35 lineage of haplogroup E originating far from the Levant in Africa.[13]

Note the TMRCA is an estimate of the time of subclade divergence. Rootsi et al. 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I, they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky. With these estimates, they are consistent with Karafet et al. 2008. A recent outlier is Underhill et al. 2007, which calculates the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky. This will need to be explained further, since they further calculate the STR variation age of I1 at only 8.1±1.5 ky.

Distribution

Haplogroup I Distribution

Rootsi et al. 2004 suggest that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the ice age.

Haplogroup I Y-chromosomes have also been found among some populations of the Middle East, the Caucasus, and Central Asia, but they are found at frequencies exceeding 10% only among populations of Europe and Asia Minor, particularly among Germanic, Slavic, Uralic, and Turkic peoples, as well as among the Romance-speaking populations of France, Romania, Moldova, and Sardinia, the Albanian-speaking population of Albania, Persian-speaking and Pamir-speaking population of Tajiks and the Greek-speaking population of Greece.It is also found among Iranian population of Tehran and Isfahan (with frequency of 34% and 10% respectively). [1]

Within Europe, several populations are distinguished by having a significantly lower frequency of Haplogroup I than the surrounding populations: these depressions in the frequency of Haplogroup I distinguish the populations of Italy and Switzerland from Germany and Sardinia, Iberia from southern France and Normandy, Greece, Albania and the Slavic peoples, and the Baltic Latvians from the Finnic Estonians. In all these areas, Haplogroup I populations are small relative to the dominant haplogroups in Europe (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).

Studies

Y-DNA haplogroup I has been researched in connection with HIV and AIDS progression. The research resulted in the finding that haplogroup I in general, and no specific subclade, had accelerated progression (in Y haplogroup I individuals) from HIV to AIDS. Suppression therapy also had a diminished effect on such individuals.[14]

Subgroups

The subclades of Haplogroup I with their defining mutations:[15]

  • I-M170 (M170, M258, P19, P38, P212, U179)
    • I1-M253 (M253, M307, M450/S109, P30, P40, S62, S63, S64, S65, S66, S107, S108, S110, S111) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe
      • I1a-M21 (M21)
      • I1b-M227 (M227) Appears to be limited to a marginally low frequency of approximately 1% among Slavic and Uralic peoples of Eastern Europe; also detected in a single Lebanese man
        • I1b1-M72 (M72)
      • I1c-P259 (P259/M507)
      • I1d-L22 (L22/S142)
        • I1d1-P109 (P109)
      • I1e-S79 (S79)
    • I2-M438 (M438/P215/S31, L68)
      • I2a-P37.2 (P37.2)
        • I2a1-M26 (M26) Typical of the population of the so-called "archaic zone" of Sardinia; also found at low frequencies among populations of Southwest Europe, particularly in Castile, Béarn, and the Basque Country
          • I2a1a-M161 (M161) Very rare (1 in Puerto Rico)
        • I2a2-M423 (M423) Typical of the Balkan populations, especially the populations of Bosnia and Herzegovina and Croatia; also found with high frequency in Moldavia and Romania and high haplotype diversity values, but lower overall frequency, among the populations of Slovakia and the Czech Republic
          • I2a2a-P41.2 (P41.2/M359.2) Very rare (2 in Bosnia and Herzegovina, 1 in Turkey, 1 in England and 1 in Croatia)
      • I2b-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32)
        • I2b1-M223 (M223, P219/S24, P220/S119, P221/S120, P222/U250/S118, P223/S117) Occurs at a moderate frequency among populations of Northwest Europe, with a peak frequency in the region of Lower Saxony in central Germany; minor offshoots appear in Moldavia and Russia (especially around Vladimir, Ryazan, Nizhny Novgorod, and the Republic of Mordovia)
          • I2b1a-M284 (M284) Generally limited to a low frequency in Great Britain
            • I2b1a1-L126 (L126/S165, L137/S166)
          • I2b1b-M379 (M379)
          • I2b1c-P78 (P78)
          • I2b1d-P95 (P95)
        • I2b2-L38 (L38/S154, L39/S155, L40/S156, L65/S159)

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..

Advertisements

I-M170

The composite subclade I contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several haplogroup I-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey (8/741), Adygea (2/138), and Iraq (1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I-M170 appear to be found among the Andalusians (3/103), French (4/179), Slovenians (2/55), and the Saami (1/35).[2]

I-M253

Density map of HG I1. The darkest areas approach only around 45% of the population.

Haplogroup I-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.

Outside Fennoscandia, distribution of Haplogroup I-M253 is closely correlated with that of Haplogroup I-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I-M253. Another characteristic of the Scandinavian I-M253 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I-M253 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I-M253 among the modern French and Italian populations.

I-M438

Distribution of HG I2a2 (M423) by region.
I-M423

Haplogroup I-M423 is the most frequent Y-chromosome Haplogroup I in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia (50-60%) and Bosnia-Herzegovina (up to 75%), especially in the Croat population of Bosnia and Herzegovina.[8] A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I-M423 is virtually absent in Fennoscandia, Western and Southwestern Europe.

I-M26

Haplogroup I-M26 is notable for its strong presence in Sardinia. Haplogroup I comprises approximately 40% of all patrilines among the Sardinians, and I-M26 is the predominant type of I among them. It has been found outside of Sardinia only at low frequencies in Southwest Europe, the Czech Republic, and the Republic of Macedonia.

Haplogroup I-M26 is practically absent east of France[citation needed] and Italy, while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Haplogroup I-M26 appears to be the only subclade of Haplogroup I found among the Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile in Spain and Béarn in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.[16]

I-M436

The distribution of Haplogroup I-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I-M253; the lack of correlation between the distributions of I-M253 and I-M436 in Fennoscandia may be a result of Haplogroup I-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I-M436, namely I-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I-M253 and Haplogroup I-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia.

Haplogroup I-M436 also occurs among approximately 1% of Sardinians.

Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca

Testing Strategy

For Haplogroup I, STR testing, with at least 25 and preferably 40 or more alleles tested, will allow accurate inference of all currently known Haplogroup I subclade single nucleotide polymorphisms (SNP). It will also provide necessary resolution to help with identifying close relatives in family history time frames. Once the STR testing results are available, one should ensure they are posted in a public database for genealogy search as well as research purposes. Then, if the lab indicates you are Haplogroup I, compare the returned STR values to an existing table of compiled Haplogroup I haplotypes to determine your specific haplotype (go to [3] and under Additional Resources, select the link to Modal Haplotypes for Y-Haplogroup I Varieties, then download FounderHaps.xls). Note that FTDNA values for your STR alleles should be used when comparing to this table. Note also that the previous version of subclade names are used. At this stage of Haplogroup I research, there is more resolution of sub-groups available through matching STR alleles with the listed haplotypes than is available via testing for known subclade SNPs. This has been the situation for a few years now, but hopefully may change when more people undergo SNP testing for some of the newer SNPs that are being discovered.

References

  1. ^ a b c Marjanovic D, Fornarino S, Montagna S, et al. (November 2005). "The peopling of modern Bosnia-Herzegovina: Y-chromosome haplogroups in the three main ethnic groups". Ann. Hum. Genet. 69 (Pt 6): 757–63. doi:10.1111/j.1529-8817.2005.00190.x. PMID 16266413. http://www3.interscience.wiley.com/resolve/openurl?genre=article&sid=nlm:pubmed&issn=0003-4800&date=2005&volume=69&issue=Pt%206&spage=757. 
  2. ^ a b c d e Rootsi S, Magri C, Kivisild T, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe". Am. J. Hum. Genet. 75 (1): 128–37. doi:10.1086/422196. PMID 15162323.& PMC 1181996. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)62002-3. 
  3. ^ Giuseppe Passarino, Gianpiero L Cavalleri, Alice A Lin et al., "Different genetic components in the Norwegian population revealed by the analysis of mtDNA and Y chromosome polymorphisms," European Journal of Human Genetics (2002) 10, 521 – 529
  4. ^ P. Francalacci, L. Morelli, P.A. Underhill et al., "Peopling of Three Mediterranean Islands (Corsica, Sardinia, and Sicily) Inferred by Y-Chromosome Biallelic Variability," American Journal of Physical Anthropology 121:270–279 (2003)
  5. ^ Andreas O Karlsson, Thomas Wallerström, Anders Götherström, and Gunilla Holmlund, "Y-chromosome diversity in Sweden – A long-time perspective," European Journal of Human Genetics (2006) 14, 963–970
  6. ^ Sanchez JJ, Borsting C, Hallenberg C, Buchard A, Hernandez A, Morling N (2003), "Multiplex PCR and minisequencing of SNPs: a model with 35 Y chromosome SNPs." Forensic Science International 137:74–84
  7. ^ a b c d Semino O, Passarino G, Oefner PJ, et al. (November 2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective". Science 290 (5494): 1155–9. doi:10.1126/science.290.5494.1155. PMID 11073453. http://www.sciencemag.org/cgi/pmidlookup?view=long&pmid=11073453. 
  8. ^ a b Pericić M, Lauc LB, Klarić IM, et al. (October 2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations". Mol. Biol. Evol. 22 (10): 1964–75. doi:10.1093/molbev/msi185. PMID 15944443. http://mbe.oxfordjournals.org/cgi/pmidlookup?view=long&pmid=15944443. "Fig. 3. — I1b* (xM26) frequency and variance surfaces ...". 
  9. ^ a b T. Lappalainen, V. Laitinen, E. Salmela et al., "Migration Waves to the Baltic Sea Region," Annals of Human Genetics (2008) doi: 10.1111/j.1469-1809.2007.00429.x
  10. ^ Kristiina Tambets, Siiri Rootsi, Toomas Kivisild et al., "The Western and Eastern Roots of the Saami—the Story of Genetic 'Outliers' Told by Mitochondrial DNA and Y Chromosomes," American Journal of Human Genetics 74:661–682, 2004
  11. ^ Alexander Varzari (2006), "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms," Dissertation for the Faculty of Biology at Ludwig-Maximilians University, München
  12. ^ Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research 18 (5): 830–8. doi:10.1101/gr.7172008. PMID 18385274.& PMC 2336805. http://www.genome.org/cgi/content/abstract/gr.7172008v1. 
  13. ^ Lancaster A (2009). "Y Haplogroups, Archaeological Cultures and Language Families: a Review of the Possibility of Multidisciplinary Comparisons Using the Case of E-M35". Journal of Genetic Genealogy. http://www.jogg.info/51/files/Lancaster.pdf. 
  14. ^ Sezgin E, Lind JM, Shrestha S, et al. (April 2009). "Association of Y chromosome haplogroup I with HIV progression, and HAART outcome". Hum. Genet. 125 (3): 281–94. doi:10.1007/s00439-008-0620-7. PMID 19169712. 
  15. ^ ISOGG 2009
  16. ^ Distribution data from Rootsi, et al., Flores, et al.

External links

Phylogenetic tree and distribution maps

Mailing Lists

Projects

Other

Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L MNOPS T
|
M NO P S
| |
N O Q R

Genealogy

Up to date as of February 01, 2010

From Familypedia

In human genetics, Haplogroup I (M170, P19, M258) is a Y-chromosome haplogroup.

Haplogroup I (the letter I, not the number 1) can be found in most present-day European populations, most commonly in Scandinavia, Sardinia, and the Slavic &Bulgarian populations of the Western Balkans in southeastern Europe.

European LGM refuges, 20 kya.

According to current theories, Haplogroup I first arrived in Europe around 20,000-25,000 years ago from the Middle East, perhaps associated with the Gravettian culture[2], and just prior to the onset of the last glacial maximum (LGM). It is most closely related to Haplogroup J,the "Semitic marker" being the most common in Semitic peoples, as both Haplogroup I and Haplogroup J are descendants of Haplogroup IJ (S2, S22). Haplogroup IJ is in turn derived from Haplogroup F. The Haplogroup I Y-chromosomes found among the Scandinavians, Sardinians, and Slavs generally belong to different subclades, however (Rootsi et al. 2004), which indicates that each of the ancestral populations now dominated by a particular subclade experienced an independent population expansion, believed to reflect different migrations of people during and immediately after the ice age. Two main subgroups of Haplogroup I are I-M253/I-M307/I-P30/I-P40 which has highest frequency in Scandinavia, Iceland, and northwest Europe. The other is I-S31 which includes I-P37.2, which is the most common form in the Balkans and Sardinia, and I-S23/I-S30/I-S32/I-S33, which reaches its highest frequency along the northwest coast of continental Europe.[1]

Haplogroup I Y-chromosomes have also been found among some populations of the Middle East, the Caucasus, and Central Asia, but they are found at frequencies exceeding 10% only among populations of Europe and Asia Minor, particularly among Germanic, Slavic, Uralic, and Turkic peoples, as well as among the Romance-speaking populations of France, Romania, Moldova, and Sardinia, the Albanian-speaking population of Albania, and the Greek-speaking population of Greece.

Within Europe, several populations are distinguished by having a significantly lower frequency of Haplogroup I than the surrounding populations: these depressions in the frequency of Haplogroup I distinguish the populations of Italy and Switzerland from Germany and Sardinia, Iberia from southern France and Normandy, Greece from Albania and the Slavic peoples, and the Baltic Latvians from the Finnic Estonians. Thus, it could be said that Haplogroup I displays relatively higher frequencies among peoples who have at times been considered to be "northern barbarians". The great majority of the Y-chromosomes among even these "northern barbarians," however, is composed of the same haplogroups (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe) as the majority of the Y-chromosomes of the southerly, earlier civilized populations.

Contents

Subgroups

The subclades of Haplogroup I with their defining mutation, according to the 2006 ISOGG tree:

  • I (M170, M258, P19)
    • I*
    • I1 (P38)
      • I1*
      • I1a (M253, M307, P30, P40) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe
      • I1b (S31)
        • I1b*
        • I1b1 (P37.2) Typical of the South Slavic peoples of the Balkans, especially the populations of Bosnia and Croatia; also found with high haplotype diversity values, but lower overall frequency, among the West Slavic populations of Slovakia and the Czech Republic; a node of elevated frequency in Moldavia correlates with that observed for Haplogroup I1b2 (but not for Haplogroup I1a)
          • I1b1*
          • I1b1a (M26)
            • I1b1a1 (M161)
          • I1b1b (P41.2 (M359.2)) Typical of the population of the so-called "archaic zone" of Sardinia; also found at low frequencies among populations of Southwest Europe, particularly in Castile, Béarn, and the Basque Country
            • I1b1b*
        • I1b2 (S23, S30, S32, S33) Occurs at a moderate frequency among populations of Northwest Europe, with a peak frequency in the region of Lower Saxony in central Germany; minor offshoots appear in Moldavia and Russia (especially around Vladimir, Ryazan, Nizhny Novgorod, and the Republic of Mordovia)
          • I1b2*
          • I1b2a (M223, S24)
            • I1b2a*
            • I1b2a1 (M284) Generally limited to a low frequency in Great Britain
            • I1b2a2 (M379)
            • I1b2a3 (P78)
            • I1b2a4 (P95)

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer. Names from older literature which have now been superseded include: I1b (P37.2) now I1b1 I1b2 (M26) now I1b1b I2 (M223), later I1c (M223) now I1b2a I2a (M284), later I1c1 (M284) now I1b2a1. Future changes may occur, according to Ken Nordtvedt [3], if the P38 SNP is made equivalent to the M258, P19, and M170 SNPs. Which would change I1a to I1, I1b1 to I2a & I1b2a to I2b.

I*

The composite subclade I* contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several haplogroup I* individuals, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey (8/741), Adygea (2/138), and Iraq (1/176), even though as a whole Haplogroup I occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I* appear to be found among the Andalusians (3/103), French (4/179), Slovenians (2/55), and the Saami (1/35).

I1a

Main article: Haplogroup I1a (Y-DNA)

Haplogroup I1a (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world.

Outside Fennoscandia, distribution of Haplogroup I1a is closely correlated with that of Haplogroup I1b2; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I1a. Another characteristic of the Scandinavian I1a Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I1a Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I1a among the modern French and Italian populations. Taken together, this suggests that the Haplogroup I element of the ancestry of Scandinavians might be descended from a very small Paleolithic population of Southern European extraction, which became distinct from the ancestral population of Haplogroup I1a individuals outside Scandinavia.

It is conjectured that this shared ancestral population of I1a and I1b2, distinct from I1b1*, may have weathered the last ice age in a refuge located somewhere in the Iberian Peninsula or southern France, or perhaps the Italian Peninsula; after the end of the ice age, some of them headed northward and repopulated Northwest Europe and Scandinavia. This population appears to have carried haplogroups I1a and I1b2 at significant frequencies, with a numerical superiority of Haplogroup I1a. Their descendants are primarily found among the Germanic, Uralic, and Celtic populations of Northern Europe, although almost always overshadowed by the more prevalent carriers of Haplogroup R. If R is considered more specifically, as it is, split between R1b & R1a, then I1a shares almost equally the areas of population where it is at its peak frequencies.

I1b1*

Main article: Haplogroup I1b (Y-DNA)

Haplogroup I1b1* (P37.2) accounts for most of the Haplogroup I component in the Y-chromosome diversity of Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia and Bosnia-Herzegovina (40 - 50%).

The high frequency and diversity of Haplogroup I1b1* among populations of the Western Balkans lends support to the hypothesis that the Adriatic region of modern-day Croatia served as a refuge for populations bearing Haplogroup I1b1* during the last glacial maximum.

I1b1b

Main article: Haplogroup I1b (Y-DNA)

Haplogroup I1b1b (M359), which is found outside of Sardinia only at low frequencies in Southwest Europe, accounts for almost all of the Haplogroup I Y-chromosomes, which comprise more than 40% of all patrilines among the Sardinians.

A distinct Western European Paleolithic population that bore Haplogroup I1b1b (M26) must have existed somewhere west of the Apennines in eastern Iberia, southern France, or western Italy, from which it succeeded in the first substantial colonization of the island of Sardinia approximately 9,000 years ago. Despite the fact that the predominantly Sardinian Haplogroup I1b1b-M359 is derived from the predominantly Balkan Haplogroup I1b1*-P37.2, the derived Haplogroup I1b1b is practically absent east of France and Italy, while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Thus, Haplogroup I1b1b appears to be strongly associated with Southwest Europeans of Paleolithic ancestry, and its carriers bear only a distant relictual relationship to the I1b1*-bearing populations of the Balkans. It is also interesting that, although the distributions of Haplogroup I1b1b and the predominantly Scandinavian Haplogroup I1a overlap in parts of western France and the British Isles, and both haplogroups appear to have a very long history in Southwest Europe (and particularly France), the populations bearing these two haplogroups appear to have differentiated at a very early date and have not extensively mixed since that time. Haplogroup I1b1b appears to be the only subclade of Haplogroup I found among the Basques, although subclades of Haplogroup R1b comprise the vast majority of that people's Y-chromosome diversity. It is notable that Haplogroup I1b1b appears to be found at somewhat higher frequencies among the general populations of Castile in Spain and Béarn in France than among the population of ethnic Basques. Lastly, the unique phylogeography of this clade has caused some scientists (Gatto, Michael) to posit that the clade should be associated with the spread of Chalcolithic Megalith culture in Western Europe. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions like the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden. As of 2007, no specific study has confirmed this hypothesis, although the data in several previous studies (Rootsi, et al., Flores, et al., etc.) support this hypothesis.

I1b2

Main article: Haplogroup I1b (Y-DNA)

The distribution of Haplogroup I1b2 (S23, S30, S32, S33) is closely correlated to that of Haplogroup I1a except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1a; the lack of correlation between the distributions of I1a and I1b2 in Fennoscandia may be a result of Haplogroup I1b2's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I1b2 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I1b2 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I1b2, namely I1b2a1 (M284), has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1a and Haplogroup I1b2 seem to correlate fairly well with the extent of historical influence of Germanic peoples, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia.

Haplogroup I1b2 also occurs among approximately 1% of Sardinians.

References

  1. ^ Y-DNA Haplogroup I and its Subclades [1]

External links

Human Y-chromosome DNA (Y-DNA) haplogroups

Y-most recent common ancestor
|
A BR
B CR
C DE F
D E G H IJ K
I J L M NO P
N O Q R


This page uses content from the English language Wikipedia. The original content was at Haplogroup I (Y-DNA). The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License.

This article uses material from the "Haplogroup I (Y-DNA)" article on the Genealogy wiki at Wikia and is licensed under the Creative Commons Attribution-Share Alike License.

Advertisements






Got something to say? Make a comment.
Your name
Your email address
Message