The Full Wiki

Haplogroup R1b (Y-DNA): Wikis

  
  

Note: Many of our articles have direct quotes from sources you can cite, within the Wikipedia article! This article doesn't yet, but we're working on it! See more info or our list of citable articles.

Encyclopedia

From Wikipedia, the free encyclopedia

Haplogroup R1b

Haplogroup R1b (Y-DNA).jpg

Time of origin less than 18,500 years BP[1]
Place of origin Western Asia [2]
Ancestor R1
Descendants R1b1a (R-V88), R1b1b (R-P297)
Defining mutations 1. M343 defines R1b in the broadest sense
2. P25 defines R1b1, making up most of R1b, and is often used to test for R1b
3. In some cases, major downstream mutations such as M269 are used to identify R1b, especially in regional or out-of-date studies
Highest frequencies Western Europe, Northern Cameroon, Hazara, Bashkirs
Haplogroup R1b Distribution

In human genetics, Haplogroup R1b is the most frequently occurring Y-chromosome haplogroup in Western Europe, Bashkortostan[3] and in parts of sub-Saharan Central Africa (for example around Chad and Cameroon). R1b is also present at lower frequencies throughout Eastern Europe, Western Asia, Central Asia, parts of North Africa. Due to European emigration it also reaches high frequencies in the Americas and Australia. While Western Europe is dominated by the R1b1b2 (R-M269) branch of R1b, the Chadic-speaking area in Africa is dominated by the branch known as R1b1a (R-V88). These represent two very successful "twigs" on a much bigger "family tree".

Contents

Nomenclature

"R1b", "R1b1", and so on are "phylogenetic" or family tree based names which explain the branching of the family tree of R1b. For example R1b1a and R1b1b would be branches of R1b1, descending from a common ancestor. This means that these names can change with new discoveries.

The alternative way of naming haplogroups is to refer to the mutations used to define and identify them. Haplogroup R1b is now identified by the presence of the single-nucleotide polymorphism (SNP) mutation M343, which was discovered in 2004.[4] From 2002 to 2005, R1b was defined by the presence of SNP P25.

Standardized naming as described above, both using phylogenetic or mutational systems, was first proposed in 2002 by the Y Chromosome Consortium. Prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[5]

Since 2002, a major update of the YCC phylogenetic nomenclature was made in 2008 by Karafet et al. which took account of newer discoveries of branches which could be clearly defined by SNP mutations, including some which changed the understanding of R1b's family tree.[1] Since 2008 it has become increasing necessary to refer to the frequently updated listing made on the ISOGG website.[2]

Origins

R1b is a branch of the MNOPS "macro-haplogroup," which is one of the predominant groupings of all human male lines outside of Africa, and this whole group, along indeed with all of macro-haplogroup F, is believed to have originated in Asia.

Macro-haplogroup MNOPS

Haplogroup M. New Guinea, Melanesia, eastern Indonesia, and Polynesia.


Macro-haplogroup NO

Haplogroup N. Mainly found in North Asia and northeastern Europe.



Haplogroup O. Mainly found in East Asia, Southeast Asia, and Austronesia.



Macro-haplogroup P

Haplogroup Q. Mainly found in North Asia and the Americas.


Macro-haplogroup R
Macro-haplogroup R1

Haplogroup R1a. Mainly found in Eastern Europe, South Asia, and Central Asia.



Haplogroup R1b. Mainly found in Western Europe, Central Africa, and Central Asia.




Haplogroup R2. Mainly found in South Asia.





Haplogroup S. New Guinea, Melanesia, and eastern Indonesia.



It was initially believed that R1b, or at least the majority of it in Europe, dispersed from Iberia after the Last Glacial Maximum, and had only come from Asia much earlier. A variant of this idea was that there may have been two separate R1b dispersals in the Mesolithic period, one from Anatolia, and one from Iberia.[4] However, more recently it has become more widely accepted that R1b entered Europe from Asia more recently, perhaps in the Neolithic.[6][7]

In 2008 T. Karafet et al. estimated the age of R1 as 18,500 years before present.[1]

Root of R1b tree

The identifiers below are those from the 2010 revision of the ISOGG tree.[2]

M343
still un-defined

R-M343* (R1b*)


P25
still un-defined

R-P25* (R1b1*)


V88

R1b1a (R-V88). Most common Sub-Saharan African R1b.


P297
still un-defined

R-P297* (R1b1b*)


M73

R-M73 (R1b1b1). Found in Central Asia.


M269
still un-defined

R-M269* (R1b1b2*)


L23

R-L23 (R1b1b2a). Most common European R1b






R1b* (that is R1b with no subsequent distinguishing SNP mutations) is extremely rare. Two cases were reported in a large study of Turkey.[4] In a study of Jordan it was found that no less than 20 out of all 146 men tested (13.7%), including most notably 20 out of 45 men tested from the Dead Sea area, were positive for M173 (R1) but negative for P25 and M269, mentioned above, as well as the R1a markers SRY10831.2 and M17.[8] Hassan et al. (2008) found an equally surprising 14 out of 26 (54%) of Sudanese Fulani who were M173+ and P25-.[9] Wood et al. report 2 Egyptian cases out of a sample of 1122 people from various African countries.[10] Such cases could possibly be either R1b* (R-M343*) or R1a* (R-M420*), demonstrating the importance of checking exact mutations tested when comparing findings in this field.

It is however possible that some of the rare examples represent a reversion of marker P25 from a positive back to a negative ancestral state.[11]

Ancient clades within R1b1 (R-P25)

An up-to-date compliation of data taking the latest information into account can be found in Cruciani et al. (2010) which can be summarised as follows[12]:-

Continent Population #No. Total% R1b1* (R-P25*) R1b1a (R-V88) R1b1b2 (R-M269) R1b1b1 (R-M73)
Africa Northern Africa 691 5.9% 0.0% 5.2% 0.7% 0.0%
Africa Central Sahel Region 461 23.0% 0.0% 23.0% 0.0% 0.0%
Africa Western Africa 123 0.0% 0.0% 0.0% 0.0% 0.0%
Africa Eastern Africa 442 0.0% 0.0% 0.0% 0.0% 0.0%
Africa Southern Africa 105 0.0% 0.0% 0.0% 0.0% 0.0%
Europe Western Europeans 465 57.8% 0.0% 0.0% 57.8% 0.0%
Europe North western Europeans 43 55.8% 0.0% 0.0% 55.8% 0.0%
Europe Central Europeans 77 42.9% 0.0% 0.0% 42.9% 0.0%
Europe Italians 1173 26.6% 0.0% 0.2% 26.4% 0.0%
Europe Corsicans 141 48.9% 0.0% 0.7% 48.2% 0.0%
Europe North Eastern Europeans 74 1.4% 0.0% 0.0% 1.4% 0.0%
Europe Russians 60 6.7% 0.0% 0.0% 6.7% 0.0%
Europe Eastern Europeans 149 20.8% 0.0% 0.0% 20.8% 0.0%
Europe Balkanians 510 13.1% 0.0% 0.2% 12.9% 0.0%
Asia Western Asians 328 5.8% 0.0% 0.3% 5.5% 0.0%
Asia Southern Asians 288 4.8% 0.0% 0.0% 1.7% 3.1%
Asia South eastern Asians 10 0.0% 0.0% 0.0% 0.0% 0.0%
Asia North eastern Asians 30 0.0% 0.0% 0.0% 0.0% 0.0%
Asia Eastern Asians 156 0.6% 0.0% 0.0% 0.6% 0.0%
TOTAL 5326

R1b1*

R1b1*, like R1b* is rare. Examples are mentioned in older articles, for example two in a sample from Turkey.[4] Most cases, especially in Africa, are thought to be almost mostly in the more recently discovered sub-clade R-V88. Most or all examples of R1b therefore fall into subclades R1b1a (R-V88) or R1b1b (R-P297). Cruciani et al. in the large 2010 study found 3 cases amongst 1173 Italians, 1 out of 328 West Asians and 1 out of 156 East Asians.[12] Cases from older studies are discussed below as probable cases of R1b1a (R-V88).

R1b1a

R1b1a is defined by the presence of SNP marker V88, the discovery of which was announced in 2010 by Cruciani et al.[12] Apart from individuals in southern Europe and Western Asia, the majority of R-V88 was found in northern and central Africa:

Region Population Country Language N Total% R1b1a (R-V88) R1b1b2 (R-M269) R1b1a* (R-V88*) R1b1a4 (R-V69)
N Africa Composite Morocco AA 338 0.0% 0.3% 0.6% 0.3% 0.0%
N Africa Mozabite Berbers Algeria AA/Berber 67 3.0% 3.0% 0.0% 3.0% 0.0%
N Africa Northern Egyptians Egypt AA/Semitic 49 6.1% 4.1% 2.0% 4.1% 0.0%
N Africa Berbers from Siwa Egypt AA/Berber 93 28.0% 26.9% 1.1% 23.7% 3.2%
N Africa Baharia Egypt AA/Semitic 41 7.3% 4.9% 2.4% 0.0% 4.9%
N Africa Gurna Oasis Egypt AA/Semitic 34 0.0% 0.0% 0.0% 0.0% 0.0%
N Africa Southern Egyptians Egypt AA/Semitic 69 5.8% 5.8% 0.0% 2.9% 2.9%
C Africa Songhai Niger NS/Songhai 10 0.0% 0.0% 0.0% 0.0% 0.0%
C Africa Fulbe Niger NC/Atlantic 7 14.3% 14.3% 0.0% 14.3% 0.0%
C Africa Tuareg Niger AA/Berber 22 4.5% 4.5% 0.0% 4.5% 0.0%
C Africa Ngambai Chad NS/Sudanic 11 9.1% 9.1% 0.0% 9.1% 0.0%
C Africa Hausa Nigeria (North) AA/Chadic 10 20.0% 20.0% 0.0% 20.0% 0.0%
C Africa Fulbe Nigeria (North) NC/Atlantic 32 0.0% 0.0% 0.0% 0.0% 0.0%
C Africa Yorubad Nigeria (South) NC/Defoid 21 4.8% 4.8% 0.0% 4.8% 0.0%
C Africa Ouldeme Cameroon (Nth) AA/Chadic 22 95.5% 95.5% 0.0% 95.5% 0.0%
C Africa Mada Cameroon (Nth) AA/Chadic 17 82.4% 82.4% 0.0% 76.5% 5.9%
C Africa Mafa Cameroon (Nth) AA/Chadic 8 87.5% 87.5% 0.0% 25.0% 62.5%
C Africa Guiziga Cameroon (Nth) AA/Chadic 9 77.8% 77.8% 0.0% 22.2% 55.6%
C Africa Daba Cameroon (Nth) AA/Chadic 19 42.1% 42.1% 0.0% 36.8% 5.3%
C Africa Guidar Cameroon (Nth) AA/Chadic 9 66.7% 66.7% 0.0% 22.2% 44.4%
C Africa Massa Cameroon (Nth) AA/Chadic 7 28.6% 28.6% 0.0% 14.3% 14.3%
C Africa Other Chadic Cameroon (Nth) AA/Chadic 4 75.0% 75.0% 0.0% 25.0% 50.0%
C Africa Shuwa Arabs Cameroon (Nth) AA/Semitic 5 40.0% 40.0% 0.0% 40.0% 0.0%
C Africa Kanuri Cameroon (Nth) NS/Saharan 7 14.3% 14.3% 0.0% 14.3% 0.0%
C Africa Foulbe Cameroon (Nth) NC/Atlantic 18 11.1% 11.1% 0.0% 5.6% 5.6%
C Africa Moundang Cameroon (Nth) NC/Adamawa 21 66.7% 66.7% 0.0% 14.3% 52.4%
C Africa Fali Cameroon (Nth) NC/Adamawa 48 20.8% 20.8% 0.0% 10.4% 10.4%
C Africa Tali Cameroon (Nth) NC/Adamawa 22 9.1% 9.1% 0.0% 4.5% 4.5%
C Africa Mboum Cameroon (Nth) NC/Adamawa 9 0.0% 0.0% 0.0% 0.0% 0.0%
C Africa Composite Cameroon (Sth) NC/Bantu 90 0.0% 1.1% 0.0% 1.1% 0.0%
C Africa Biaka Pygmies CAR NC/Bantu 33 0.0% 0.0% 0.0% 0.0% 0.0%
W Africa Composite 123 0.0% 0.0% 0.0% 0.0% 0.0%
E Africa Composite 442 0.0% 0.0% 0.0% 0.0% 0.0%
S Africa Composite 105 0.0% 0.0% 0.0% 0.0% 0.0%
TOTAL 1822
M343
still un-defined

R-M343* (R1b*)


P25
still un-defined

R-P25* (R1b1*)


V88
still un-defined

R-V88* (R1b1a*)


M18

R-M18 (R1b1a1)


V8

R-V8 (R1b1a2)


V35

R-V35 (R1b1a3)


V69

R-V69 (R1b1a4)




R-P297 (R1b1b)




As can be seen in the above data table, R1b1a is found in northern Cameroon in west central Africa at a very high frequency, where it is considered to be caused by a pre-Islamic movement of people from Eurasia.[13][10]

Suggestive results from other studies which did not test for the full range of new markers discovered by Cruciani et al. have also been reported, which might be in R-V88.

  • Wood et al. reported high frequencies of men who were R-P25 positive and M269 negative, amongst the same north Cameroon area where Cruciani et al. reported high R-V88 levels. However they also found such cases amongst 3% (1/32) of Fante from Ghana, 9% (1/11) of Bassa from southern Cameroon, 4% (1/24) of Herero from Namibia, 5% (1/22) of Ambo from Namibia, 4% (4/92) of Egyptians, and 4% (1/28) of Tunisians. [10]
  • Luis et al. found the following cases of men M173 positive (R1), but negative for M73 (R1b1b1), M269 (R1b1b2), M18 (R1b1a1, a clade with V88, M18 having been discovered before V88) and M17 (R1a1a): 1 of 121 Omanis, 3 of 147 Egyptians, 2 of 14 Bantu from southern Cameroon, and 1 of 69 Hutu from Rwanda.[14]

R1b1a1

R1b1a1 is a sub-clade of R-V88 which is defined by the presence of SNP marker M18.[1] It has been found only at low frequencies in samples from Sardinia[15][16] and Lebanon.[17]

R1b1b

R1b1b is defined by the presence of SNP marker P297. In 2008 this polymorphism was recognised to combine M73 and M269 into one R1b1b cluster.[1] The majority of Eurasian R1b is within this clade, representing a very large modern population, which has been relatively well studied, therefore the branching within this clade can be explained in detail below.

R1b1c

R1b1c is defined by the presence of SNP marker M335. This haplogroup was created by the 2008 reorganisation of nomenclature and should not be confused with R1b1b2, which was previously called R1b1c. Its position in relation to the much more populous sub-clade R1b1b is uncertain.[1] The M335 marker was first published in 2004, when one example was discovered in Turkey, which was classified at that time as R1b4.[4]

Major clades within R1b1b (R-P297)

R1b1b1

R1b1b1 is defined by the presence of SNP marker M73. It has been found at generally low frequencies throughout central Eurasia,[15] and with relatively high frequency among Hazaras in Pakistan (8/25 = 32%[18]) and among Bashkirs in Bashkortostan (62/471 = 13.2%), 44 of these being found among the 80 tested Bashkirs of the Abzelilovsky District in the Republic of Bashkortostan (55.0%).[19]

R1b1b2

R1b1b2 is defined by the presence of SNP marker M269. It has been found at generally low frequencies throughout central Eurasia,[15] and with relatively high frequency among Bashkirs of the Bashkortostan and Perm region (84.0%).[20]

R-M269
Long-hand: R1b1b2 (formerly R1b1c, R1b3)
Defining SNP: M269
Parent Clade: R-P297
Subclades: R-P311

This subclade is defined by the presence of the M269 marker. From 2003 to 2005 what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c.

M269
still un-defined

R-M269* (R1b1b2*)


L23
still un-defined

R-L23* (R1b1b2a*)


L51
still un-defined

R-L51* (R1b1b2a1*)


P310/L11
still un-defined

R-P310/L11* (R1b1b2a1a*)


U106

R-U106 (R1b1b2a1a1)


P312

R-P312 (R1b1b2a1a2)






In articles published around 2000 it was proposed that this clade came into existence in Europe before the last Ice Age,[21] but more recently this scenario is no longer receiving much mainstream attention. A much newer estimate for R1b1b2 arising is around 5,000 to 8,000 years ago.[7] It also appears increasingly to be the case that Western European R1b is dominated by R-P310, also known as R-L11. It is this Western European branch which is in turn dominated by U106 and P312, and the typical most common STR Y DNA signature for Western Europe, the so-called Atlantic Modal Haplotype, which is also sometimes referred to as "Haplotype 15". Haplotype 15 is contrasted with "Haplotype 35", which has long been noted as a distinct type of R1b1b2, more common towards the southeast of Europe.

R1b1b2a1a1 (R-U106)

This subclade is defined by the presence of the marker U106, also known as S21 and M405. It appears to represent over 25% of R1b in Europe.

R-U106
Long-hand: R1b1b2a1a/R1b1b2g/R1b1c9
Defining SNP: U106/S21/M405
Parent Clade: P310/S129
Subclades: U198/S29/M405, S26/L1/DYS439(null), L48/S162 (comprising L44, L45, L46, L47), L5, L6, P89.2, P107
U106
still un-defined

R-U106* (R1b1b2a1a1*)


U198

R-U198 (R1b1b2a1a1a)


S26

R-S26 (R1b1b2a1a1c)


L48

R-L48* (R1b1b2a1a1d*)


L47

R-L47* (R1b1b2a1a1d1*)



R-L44 (R1b1b2a1a1d1a)





In Europe, the subclade (including its own subclades) has a distribution running north west to east and is found in higher concentrations in England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in the Netherlands (37.2%) and slopes down to the east through Germany (20.5%) and the Alps (Switzerland 13.3%, Austria 22.7%) towards the Czech Republic (13.9%) and Ukraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% in Poland and 7.2% in Russia. The subclade appears to be omnipresent in Europe, although it becomes less pronounced in Ireland (5.9%) and France (7.1%) and, further towards the Mediterranean, low values are measured in, Italy (3.5%), and Turkey (0.4%).[22] The frequency of this subclade remains unknown in certain parts of Europe such as Iberia and the Balkans.

The age of U106 is around 3,100-3,900 years old.[citation needed]

The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106").[23]

Craig Venter and James Watson, who in 2007 became the first two individuals to have their complete genomes published, both belong to this subclade.

Downstream of U106 are U198/S29/M467, P107, P89.2, L1/S26/DYS439(null), L5, L6, L48/S162 (with L47, which contains L44 - further subdivided in the L45, L46 and L164 subgroups; L148; L179; and L188), L127.2 and L199.

R1b1b2a1a1a

This subclade is defined by the presence of the marker U198, also known as S29 and M467. Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown if this marker arrived in England with the Anglo-Saxons in the 5th Century. Only low values of the marker have been detected over a wide area that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).[22] The age of U198 is around 2-3,000 years.

R1b1b2a1a1c

This subclade is defined by the presence of the marker L1/S26/DYS439(null). It occurs in less than half of a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry,[24] is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or null439.[25]

R1b1b2a1a1d

This subclade is defined by the presence of the marker L48/S162 and is also known as R1b1b2a1a4 (by Family Tree DNA - FTDNA). It is the largest subclade of R1b1b2a1a1. As of January 23, 2010, based on FTDNA tests of samples from 455 people, L48 was detected in 267, or 58.0% of those tested. Based on May 2009 results, from among those with L48+ results at that time, 90% had DYS390 of 23 or less, while 10% a value of 24 or more. Among those tested L48-, 16% had DYS390 of 23 or less, while 84% a value of 24 or more. Therefore, there seems to be a correlation between values of 23 or lower for DYS390 and L48+, among those tested U106+.[26] The age of L48 is around 2,900-3,100 years old.

R1b1b2a1a1d has a subclade R1b1b2a1a1d1 (defined by the marker L47), which in turn, seems to be including subclades R1b1b2a1a1d1*, R1b1b2a1a1d1a defined by the marker L44. Furthermore, L44 comprises L45, L46, L164 and L237.[27]

As of January 23, 2010, based on FTDNA tests of samples from the R1b-U106 project, there were 87 published test results (including Craig Venter's) for L47, with 21 positive (24.1%), including 13 persons originated from the United Kingdom, one person from Picardy, France and one Ashkenazi person of probable Sephardic origin (so called Iberian Ashkenazim) from Belarus[28]. As well, due to the genetic distances among the members so far L47+, the age of this cluster is probably quite old, perhaps 2,700-2,900 years[citation needed]. It is possible that L47 emerged not too long after the L48 "parent" cluster. Preliminary data would strongly suggest that the L48 SNP occurred only a short period of time after the U106 SNP occurred, likely 200 years or less[citation needed].

With limited data for L46+ haplotypes at this point, it would appear that the L47 SNP occurred only a short period of time after the L48 SNP occurred, likely 200 years or less. However, more results and proper statistical analysis will be required. So far, these are only observations based on a few initial results. Downstream of L47 is also rs9786514 A+, which defines a new sub-haplogroup of L147 ("R1b1b2a1a1d1b").

For the R1b1b2a1a1d1a defined by marker L44, as of January 23, 2010, based on FTDNA tests of samples from the R1b-U106 project, there were 59 test results for L44, with 6 positive (10.2%) and 53 negative. Downstream of L44, L46 has 56 test results, with 4 positive (7.1%) and 52 negative. As well, it is possible that L45 could be downstream of L44 and upstream of 46, but FTDNA has not started testing L45 yet. The age of L46 could be around 1,500 years before present (YBP)[citation needed].

R1b1b2a1a1d has another subclade defined by the marker L148. As of January 23, 2010, based on FTDNA tests of samples from the R1b-U106 project, there were 19 test results for L148, with 3 positive (15.8%) and 16 negative.[29]. FamilyTreeDNA's Houston Lab Director, Thomas Krahn, has posted a working YDNA tree showing potential new subclades, under R1b1b2a1a1d, defined by markers L179, L180, L188, L200, and M157.2.[30] Their frequency remains unknown.[31].

R1b1b2a1a2 (R-P312)

The P312 SNP appears to account for at least half of European R1b1b2. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of this SNP relative to the above list.

R-P312
Long-hand: R1b1b2a1a2
Defining SNP: P312 (also called S116, rs34276300)
Parent Clade: R-P310
Subclades: R-M153, R-M167, R-U152, R-L21
P312
still un-defined

R-P312* (R1b1b2a1a2*)


M65

R-M65 (R1b1b2a1a2a)


M153

R-M153 (R1b1b2a1a2b)


M167

R-M167 (R1b1b2a1a2c)


U152
still un-defined

R-U152* (R1b1b2a1a2d*)


L2/S139

R-L2* (R1b1b2a1a2d3*)



R-L20 (R1b1b2a1a2d3a)




L165/S68

R-L165/S68 (R1b1b2a1a2e)


L21/S145

R-L21* (R1b1b2a1a2f*)



R-M222 (R1b1b2a1a2f2)



R-L226/S168 (R1b1b2a1a2f4)




R1b1b2a1a2b

This subclade is defined by the presence of the marker R-M153. It has been found mostly in Basques and Gascons, among whom it represents a sizeable fraction of the Y-DNA pool[32][33][34], though is also found occasionally among Iberians in general. The first time it was located (Bosch 2001[35]) it was described as H102 and included 7 Basques and one Andalusian.

R1b1b2a1a2c

This subclade is defined by the presence of the marker R-M167/SRY2627. The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[36]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.

In 2000 Rosser[37] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.

In 2001 Bosch described this marker as H103, in 5 Basques and 5 Catalans.[35] Further regional studies have located it in significant amounts in Asturias, Cantabria and Galicia, as well as again among Basques.[38] Cases in the Azores and Latin America have also been reported. In 2008 two research papers by López-Parra[34] and Adams,[33] respectively, identified it as very important in all the Pyrenees, with some presence further south in Iberia (specially in the Eastern half but also in Northern Portugal). It is specially prevalent among Catalans, where it includes some 20% of all men.

R1b1b2a1a2d

This subclade is defined by the presence of the marker R-U152 also called S28[39]. Its discovery was announced in 2005 by EthnoAncestry[24] and subsequently identified independently by Sims et al. (2007).[40] Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. The Iron Age La Tène culture originated in this area, but an association with R1b1b2a1a2d has yet to be demonstrated.

It is found from Greece westward to the Bay of Biscay in France, but the percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain[citation needed]. Northern Italy seems to be a meeting place for both U106 and U152.

R1b1b2a1a2e

This subclade is defined by the presence of the marker S68 which was reported by in 2007. It has been seen in an individual from Scotland and another from Sweden. This subclade is unlikely to be found in much more than 2% of the R1b population.[24] In Fall 2009 Family Tree DNA discovered the same SNP in and named it L165.

R1b1b2a1a2f

This subclade is defined by the presence of the marker L21. Early results suggest that it is common in Britain, Ireland and possibly northern France. It is also apparently common in Germany and Scandinavia, but is rare in Iberian or Italian male lines.

R1b1b2a1a2f2

This subclade is defined by the presence of the marker M222. It is particularly associated with male lines which are Irish or Scottish. In this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as it is suggested to have been the Y-chromosome haplogroup of the Uí Néill dynastic kindred of ancient Ireland.[41][42] However it is not restricted to the Uí Néill as it is also associated with the closely related Connachta dynasties, called the Uí Briúin and Uí Fiachrach.[43] In addition it is also found in southern Scotland and so is thus commonly referred to as the Northwest Irish/Lowland Scots Variety.

R1b1b2a1a2f4

This subclade is defined by the presence of the marker L226/S168. Commonly referred to as Irish Type III, it is concentrated in central western Ireland and associated with the Dál gCais kindred.[44][45]

Distribution

R1b reaches its highest frequency in Atlantic Europe. Results from studies with small sample sizes should be treated with caution until more thorough testing is completed.

Eurasia

  • In South Asia, R1b is present at 8% in Iranians,[78] 7.4% in Pakistanis (including 4.5% R1b1b1-M73 and 2.8% R1b1b2-M269), while it is almost not found in India (0.55% R1b1b2-M269).[18] Haplogroup R1b1b2-M269 has been found in approximately 11% of a sample of Newars in Nepal.[79]
  • In the Caucasus, haplogroup R1b may be found in 43% of Ossetian males[57] and in as many as 32.4% (238/734 P-92R7(xR1a1-SRY10831b))[80] to 36% (17/47 R1-M173(xR1a1a-M17))[64] of Armenians. It also has been found with lower frequency among Georgians (6/66 = 9.1% R1b1b2-M269[81] to 9/63 = 14.3% R1-M173(xR1a1a-M17)[82]) and Balkarians (2/38 = 5.3% R1b1-P25(xR1b1b2-M269) and 3/38 = 7.9% R1b1b2-M269 for a total of 5/38 = 13.2% R1b[81]).

Africa

Haplotypes

Atlantic Modal Haplotype

A common haplotype within R1b is sometimes called the Atlantic Modal Haplotype, or haplotype 15. It reaches the highest frequencies in the Iberian Peninsula and in Great Britain and Ireland. In the Iberian Peninsula it reaches 70% in Portugal as a whole and more than 90% in NW Portugal, while the highest value is to be found among Spanish Basques. It was discovered prior to many of the SNPs now used to identify subclades of R1b and references to it can be found in some of the older literature. It corresponds most closely with subclade R1b1b2a1a [L11].

Haplotype 35

There also exists a haplotype associated with R1b1b2 characterized by DYS393=12 which is known in the literature as Haplotype 35 (ht35), or the Armenian Modal Haplotype.[citation needed]

Popular culture

Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve.

Stephen Oppenheimer also deals with this haplogroup in his book Origins of the British, giving the R1b clan patriarch the Basque name "Ruisko" in honour of what he thought was the Iberian origin of R1b.

See also

Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor
|
A BT
|
B CT
|
CF DE
| |
C F D E
|
G H IJK
|
IJ K
| |
I J L MNOPS T
|
M NO P S
| |
N O Q R
R
R1

R1a



R1b




R2



References

  1. ^ a b c d e f Karafet, TM; Mendez, FL; Meilerman, MB; Underhill, PA; Zegura, SL; Hammer, MF (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree.". Genome research 18 (5): 830–8. doi:10.1101/gr.7172008. PMID 18385274. 
  2. ^ a b c International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades
  3. ^ A. S. Lobov et al. (2009), "Y chromosome analysis in subpopulations of Bashkirs from Russia" (original text in Russian)
  4. ^ a b c d e Cinnioğlu, C; King, R; Kivisild, T; Kalfoğlu, E; Atasoy, S; Cavalleri, GL; Lillie, AS; Roseman, CC et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia.". Human genetics 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf. 
  5. ^ Y Chromosome Consortium (18 January 2002). "YCC NRY Tree 2002". http://ycc.biosci.arizona.edu/nomenclature_system/fig1.html. Retrieved 13 December 2007. 
  6. ^ "The distribution of this lineage, the diversity within it, and estimates of its age all suggest that it spread with farming from the Near East...Previous studies suggested a Paleolithic origin, but here we show that the geographical distribution of its microsatellite diversity is best explained by spread from a single source in the Near East via Anatolia during the Neolithic", Balaresque et al. 2010,A Predominantly Neolithic Origin for European Paternal Lineages
  7. ^ a b B. Arredi, E. S. Poloni and C. Tyler-Smith (2007). "The peopling of Europe". in Crawford, Michael H.. Anthropological genetics: theory, methods and applications. Cambridge, UK: Cambridge University Press. p. 394. ISBN 0-521-54697-4. 
  8. ^ a b Flores, C; Maca-Meyer, N; Larruga, JM; Cabrera, VM; Karadsheh, N; Gonzalez, AM (2005). "Isolates in a corridor of migrations: a high-resolution analysis of Y-chromosome variation in Jordan.". Journal of human genetics 50 (9): 435–41. doi:10.1007/s10038-005-0274-4. PMID 16142507. 
  9. ^ a b c Hassan, HY; Underhill, PA; Cavalli-Sforza, LL; Ibrahim, ME (2008). "Y-chromosome variation among Sudanese: restricted gene flow, concordance with language, geography, and history.". American journal of physical anthropology 137 (3): 316–23. doi:10.1002/ajpa.20876. PMID 18618658. http://dirkschweitzer.net/E3b-papers/Hassan-Sudan-2008-AJPA.pdf. "13/32". 
  10. ^ a b c Wood, ET; Stover, DA; Ehret, C; Destro-Bisol, G; Spedini, G; Mcleod, H; Louie, L; Bamshad, M et al. (2005). "Contrasting patterns of Y chromosome and mtDNA variation in Africa: evidence for sex-biased demographic processes.". European journal of human genetics : EJHG 13 (7): 867–76. doi:10.1038/sj.ejhg.5201408. PMID 15856073. http://hammerlab.biosci.arizona.edu/publications/Wood_2005_EUR.pdf. 
  11. ^ Adams, SM; King, TE; Bosch, E; Jobling, MA (2006). "The case of the unreliable SNP: recurrent back-mutation of Y-chromosomal marker P25 through gene conversion.". Forensic science international 159 (1): 14–20. doi:10.1016/j.forsciint.2005.06.003. PMID 16026953. 
  12. ^ a b c Cruciani et al. (2010), "Human Y chromosome haplogroup R-V88: a paternal genetic record of early mid Holocene trans-Saharan connections and the spread of Chadic languages", European Journal of Human Genetics, doi:10.1038/ejhg.2009.231, http://www.nature.com/ejhg/journal/vaop/ncurrent/abs/ejhg2009231a.html 
  13. ^ Cruciani, F; Santolamazza, P; Shen, P; Macaulay, V; Moral, P; Olckers, A; Modiano, D; Holmes, S et al. (2002). "A back migration from Asia to sub-Saharan Africa is supported by high-resolution analysis of human Y-chromosome haplotypes.". American journal of human genetics 70 (5): 1197–214. doi:10.1086/340257. PMID 11910562. , pp. 13–14
  14. ^ Luis, JR; Rowold, DJ; Regueiro, M; Caeiro, B; Cinnioğlu, C; Roseman, C; Underhill, PA; Cavalli-Sforza, LL et al. (2004). "The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations.". American journal of human genetics 74 (3): 532–44. doi:10.1086/382286. PMID 14973781. 
  15. ^ a b c Peter A. Underhill, Peidong Shen, Alice A. Lin et al., "Y chromosome sequence variation and the history of human populations," Nature Genetics, Volume 26, November 2000
  16. ^ Contu, D; Morelli, L; Santoni, F; Foster, JW; Francalacci, P; Cucca, F; Hawks, John (2008). "Y-chromosome based evidence for pre-neolithic origin of the genetically homogeneous but diverse Sardinian population: inference for association scans.". PloS one 3 (1): e1430. doi:10.1371/journal.pone.0001430. PMID 18183308. 
  17. ^ Zalloua, PA; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ et al. (2008). "Y-chromosomal diversity in Lebanon is structured by recent historical events.". American journal of human genetics 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMID 18374297. 
  18. ^ a b Sengupta, S; Zhivotovsky, LA; King, R; Mehdi, SQ; Edmonds, CA; Chow, CE; Lin, AA; Mitra, M et al. (February 2006). "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists". American journal of human genetics 78 (2): 202–21. doi:10.1086/499411. PMID 16400607. "8/176 R-M73 and 5/176 R-M269 for a total of 13/176 R1b in Pakistan and 4/728 R-M269 in India". 
  19. ^ A. S. Lobov et al. (2009), "Y chromosome analysis in subpopulations of Bashkirs from Russia" (original text in Russian)
  20. ^ A. S. Lobov et al. (2009), "Y chromosome analysis in subpopulations of Bashkirs from Russia" (original text in Russian)
  21. ^ Semino, O; Passarino, G; Oefner, PJ; Lin, AA; Arbuzova, S; Beckman, LE; De Benedictis, G; Francalacci, P et al. (2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective.". Science 290 (5494): 1155–9. doi:10.1126/science.290.5494.1155. PMID 11073453. 
  22. ^ a b Myres, NM; Ekins, JE; Lin, AA; Cavalli-Sforza, LL; Woodward, SR; Underhill, PA (2007). "Y-chromosome short tandem repeat DYS458.2 non-consensus alleles occur independently in both binary haplogroups J1-M267 and R1b3-M405.". Croatian medical journal 48 (4): 450–9. PMID 17696299. PMC 2080563. http://www.cmj.hr/2007/48/4/17696299.htm. 
  23. ^ Sims, LM; Garvey, D; Ballantyne, J (2007). "Sub-populations within the major European and African derived haplogroups R1b3 and E3a are differentiated by previously phylogenetically undefined Y-SNPs.". Human mutation 28 (1): 97. doi:10.1002/humu.9469. PMID 17154278. http://www3.interscience.wiley.com/homepages/38515/pdf/940.pdf. 
  24. ^ a b c http://ethnoancestry.com/R1b.html
  25. ^ Family Tree DNA: Null 439
  26. ^ results
  27. ^ [1]
  28. ^ [2]
  29. ^ [3]
  30. ^ [4]
  31. ^ [5]
  32. ^ McEwan's Genealogy Page: "R1b1c4 aka M153"
  33. ^ a b c d e Adams, SM; Bosch, E; Balaresque, PL; Ballereau, SJ; Lee, AC; Arroyo, E; López-Parra, AM; Aler, M et al. (2008). "The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula". American journal of human genetics 83 (6): 725–36. doi:10.1016/j.ajhg.2008.11.007. PMID 19061982. 
  34. ^ a b López-Parra, AM; Gusmão, L; Tavares, L; Baeza, C; Amorim, A; Mesa, MS; Prata, MJ; Arroyo-Pardo, E (2009). "In search of the pre- and post-neolithic genetic substrates in Iberia: evidence from Y-chromosome in Pyrenean populations.". Annals of human genetics 73 (1): 42–53. doi:10.1111/j.1469-1809.2008.00478.x. PMID 18803634. 
  35. ^ a b Bosch, E; Calafell, F; Comas, D; Oefner, PJ; Underhill, PA; Bertranpetit, J (2001). "High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula.". American journal of human genetics 68 (4): 1019–29. doi:10.1086/319521. PMID 11254456. 
  36. ^ Hurles, ME; Veitia, R; Arroyo, E; Armenteros, M; Bertranpetit, J; Pérez-Lezaun, A; Bosch, E; Shlumukova, M et al. (1999). "Recent male-mediated gene flow over a linguistic barrier in Iberia, suggested by analysis of a Y-chromosomal DNA polymorphism.". American journal of human genetics 65 (5): 1437–48. doi:10.1086/302617. PMID 10521311. 
  37. ^ a b c d Rosser, ZH; Zerjal, T; Hurles, ME; Adojaan, M; Alavantic, D; Amorim, A; Amos, W; Armenteros, M et al. (2000). "Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language.". American journal of human genetics 67 (6): 1526–43. doi:10.1086/316890. PMID 11078479. 
  38. ^ McEwan Genealogy Page: "M167 aka SRY2627 R1b1c6 subclade"
  39. ^ Faux, David H. Y-Chromosome Marker S28 / U152 Haplogroup R-U152 Resource Page Retrieved 2010-02-13
  40. ^ McEwan Genealogy Page S28
  41. ^ Moore et al. (2006), A Y-Chromosome Signature of Hegemony in Gaelic Ireland, http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1380239/ 
  42. ^ http://www.m222.net/R1b1c7.htm
  43. ^ O'Neill and McLaughlin. Insights Into the O'Neills of Ireland from DNA Testing. Journal of Genetic Genealogy. 2006.
  44. ^ Irish Type III Website
  45. ^ Wright (2009), "A Set of Distinctive Marker Values Defines a Y-STR Signature for Gaelic Dalcassian Families", Journal of Genetic Genealogy, http://www.jogg.info/51/files/Wright.htm 
  46. ^ http://www.roperld.com/YBiallelicHaplogroups.htm
  47. ^ a b c d e f g Semino, O; Santachiara-Benerecetti, AS; Falaschi, F; Cavalli-Sforza, LL; Underhill, PA (2002). "Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny.". American journal of human genetics 70 (1): 265–8. doi:10.1086/338306. PMID 11719903. 
  48. ^ 286/348, "The genetic position of Western Brittany (Finistère, France) in the Celtic Y chromosome landscape", K.Rouault et al. 2009
  49. ^ Lyon(n=129), Strasbourg (n=99), Kalevi Wiik, Where did European Men Come From ?, Journal of Genetic Genealogy 4:35-85, 2008 , p.77
  50. ^ Beleza, S; Gusmão, L; Lopes, A; Alves, C; Gomes, I; Giouzeli, M; Calafell, F; Carracedo, A et al. (2006). "Micro-phylogeographic and demographic history of Portuguese male lineages.". Annals of human genetics 70 (Pt 2): 181–94. doi:10.1111/j.1529-8817.2005.00221.x. PMID 16626329. "395/657". 
  51. ^ Capelli, C; Brisighelli, F; Scarnicci, F; Arredi, B; Caglia', A; Vetrugno, G; Tofanelli, S; Onofri, V et al. (2007). "Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter.". Molecular phylogenetics and evolution 44 (1): 228–39. doi:10.1016/j.ympev.2006.11.030. PMID 17275346. "280/699". 
  52. ^ a b Kayser, M; Lao, O; Anslinger, K; Augustin, C; Bargel, G; Edelmann, J; Elias, S; Heinrich, M et al. (2005). "Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis.". Human genetics 117 (5): 428–43. doi:10.1007/s00439-005-1333-9. PMID 15959808. "473/1215". 
  53. ^ a b Helgason, A; Sigureardottir, S; Nicholson, J; Sykes, B; Hill, E; Bradley, D; Bosnes, V; Gulcher, J et al. (2000). "Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland". The American Journal of Human Genetics 67: 697. doi:10.1086/303046. 
  54. ^ Di Gaetano, C; Cerutti, N; Crobu, F; Robino, C; Inturri, S; Gino, S; Guarrera, S; Underhill, PA et al. (2009). "Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome.". European journal of human genetics : EJHG 17 (1): 91–9. doi:10.1038/ejhg.2008.120. PMID 18685561. "57/232". 
  55. ^ Zalloua, PA; Platt, DE; El Sibai, M; Khalife, J; Makhoul, N; Haber, M; Xue, Y; Izaabel, H et al. (2008). "Identifying genetic traces of historical expansions: Phoenician footprints in the Mediterranean.". American journal of human genetics 83 (5): 633–42. doi:10.1016/j.ajhg.2008.10.012. PMID 18976729. 
  56. ^ Contu, D; Morelli, L; Santoni, F; Foster, JW; Francalacci, P; Cucca, F; Hawks, John (2008). "Y-chromosome based evidence for pre-neolithic origin of the genetically homogeneous but diverse Sardinian population: inference for association scans.". PloS one 3 (1): e1430. doi:10.1371/journal.pone.0001430. PMID 18183308. "174/930". 
  57. ^ a b c d e f g h i j Pericić, M; Lauc, LB; Klarić, IM; Rootsi, S; Janićijevic, B; Rudan, I; Terzić, R; Colak, I et al. (2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations.". Molecular biology and evolution 22 (10): 1964–75. doi:10.1093/molbev/msi185. PMID 15944443.  Haplogroup frequency data in table 1
  58. ^ a b Varzari, Alexander (27 July 2006). "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms". 
  59. ^ a b Tambets et al. (2004).
  60. ^ King, RJ; Ozcan, SS; Carter, T; Kalfoğlu, E; Atasoy, S; Triantaphyllidis, C; Kouvatsi, A; Lin, AA et al. (2008). "Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic.". Annals of human genetics 72 (Pt 2): 205–14. doi:10.1111/j.1469-1809.2007.00414.x. PMID 18269686. 
  61. ^ Regueiro et al., M; Cadenas, AM; Gayden, T; Underhill, PA; Herrera, RJ (2006). "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration". Hum Hered 61 (3): 132–143. doi:10.1159/000093774. PMID 16770078. http://content.karger.com/ProdukteDB/produkte.asp?Aktion=ShowPDF&ArtikelNr=93774&ProduktNr=224250&filename=93774.pdf. 
  62. ^ 76/523
    Cinnioğlu, C; King, R; Kivisild, T; Kalfoğlu, E; Atasoy, S; Cavalleri, GL; Lillie, AS; Roseman, CC et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia.". Human genetics 114 (2): 127–48. doi:10.1007/s00439-003-1031-410.1007/s00439-003-1031-4 (inactive 2009-09-30). PMID 14586639. 
  63. ^ Al-Zahery, N; Semino, O; Benuzzi, G; Magri, C; Passarino, G; Torroni, A; Santachiara-Benerecetti, AS (2003). "Y-chromosome and mtDNA polymorphisms in Iraq, a crossroad of the early human dispersal and of post-Neolithic migrations". Molecular phylogenetics and evolution 28 (3): 458–72. doi:10.1016/S1055-7903(03)00039-3. PMID 12927131. "16/139". 
  64. ^ a b c d e f Wells RS, Yuldasheva N, Ruzibakiev R, et al. (August 2001). "The Eurasian heartland: a continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMID 11526236. 
  65. ^ a b Nebel et al. (2001)
  66. ^ Nasidze et al. (2005)
  67. ^ a b Cruciani et al. (2004)
  68. ^ a b Semino et al. (2000)
  69. ^ a b Hammer et al. (2000)
  70. ^ Hammer et al. (2000)
  71. ^ Di Giacomo et al. (2004)
  72. ^ Cruciani et al. 2004
  73. ^ Semino et al. (2004)
  74. ^ Zalloua, PA; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ et al. (2008). "Y-chromosomal diversity in Lebanon is structured by recent historical events.". American journal of human genetics 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMID 18374297. "47/935". 
  75. ^ 7/164, Cadenas et al. 2008
  76. ^ Zhou, R; Yang, D; Zhang, H; Yu, W; An, L; Wang, X; Li, H; Xu, J et al. (2008). "Origin and evolution of two Yugur sub-clans in Northwest China: a case study in paternal genetic landscape.". Annals of human biology 35 (2): 198–211. doi:10.1080/03014460801922927. PMID 18428013. 
  77. ^ Xue, Y; Zerjal, T; Bao, W; Zhu, S; Shu, Q; Xu, J; Du, R; Fu, S et al. (April 2006). "Male demography in East Asia: a north-south contrast in human population expansion times". Genetics 172 (4): 2431–9. doi:10.1534/genetics.105.054270. PMID 16489223. 
  78. ^ Regueiro et al., M; Cadenas, AM; Gayden, T; Underhill, PA; Herrera, RJ (2006). "Iran: Tricontinental Nexus for Y-Chromosome Driven Migration". Hum Hered 61 (3): 132–143. doi:10.1159/000093774. PMID 16770078. http://content.karger.com/ProdukteDB/produkte.asp?Aktion=ShowPDF&ArtikelNr=93774&ProduktNr=224250&filename=93774.pdf. 
  79. ^ Gayden, T; Cadenas, AM; Regueiro, M; Singh, NB; Zhivotovsky, LA; Underhill, PA; Cavalli-Sforza, LL; Herrera, RJ (2007). "The Himalayas as a directional barrier to gene flow.". American journal of human genetics 80 (5): 884–94. doi:10.1086/516757. PMID 17436243. 
  80. ^ Weale, ME; Yepiskoposyan, L; Jager, RF; Hovhannisyan, N; Khudoyan, A; Burbage-Hall, O; Bradman, N; Thomas, MG (2001). "Armenian Y chromosome haplotypes reveal strong regional structure within a single ethno-national group.". Human genetics 109 (6): 659–74. doi:10.1007/s00439-001-0627-9. PMID 11810279. 
  81. ^ a b Battaglia, V; Fornarino, S; Al-Zahery, N; Olivieri, A; Pala, M; Myres, NM; King, RJ; Rootsi, S et al. (2009). "Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe.". European journal of human genetics : EJHG 17 (6): 820–30. doi:10.1038/ejhg.2008.249. PMID 19107149. 
  82. ^ Semino, O.; Passarino, G; Oefner, PJ; Lin, AA; Arbuzova, S; Beckman, LE; De Benedictis, G; Francalacci, P et al. (2000). "The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective". Science 290 (5494): 1155. doi:10.1126/science.290.5494.1155. PMID 11073453. 
  83. ^ A. S. Lobov et al. - Y chromosome analysis in subpopulations of Bashkirs from Russia, 2005
  84. ^ A. S. Lobov et al. (2009), "Y chromosome analysis in subpopulations of Bashkirs from Russia" (original text in Russian)
  85. ^ http://www.ddl.ish-lyon.cnrs.fr/fulltext/Van%20Der%20Veen/Van%20der%20Veen_2007_Porquerolles.pdf
  86. ^ 6/147, Luis et al. 2001
  87. ^ 3/19 Arredi et al. 2004
  88. ^ Robino, C; Crobu, F; Di Gaetano, C; Bekada, A; Benhamamouch, S; Cerutti, N; Piazza, A; Inturri, S et al. (2008). "Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample.". International journal of legal medicine 122 (3): 251–5. doi:10.1007/s00414-007-0203-5. PMID 17909833. "11/102". 
  89. ^ Bosch et al. 2001
  90. ^ Maria Brotilini et al. 2004

Bibliography

  • Luigi Luca Cavalli-Sforza (1994). The History and Geography of Human Genes. Princeton University Press.  ISBN 0-691-08750-4
  • Michel Morvan (1996) The linguistic origins of basque (in french), Bordeaux University Press. ISBN 2-86781-182-1

External links

Maps

Projects


Genealogy

Up to date as of February 01, 2010

From Familypedia

Distribution of R1a (purple) and R1b (red). See also this map for distribution in Europe.

In human genetics, Haplogroup R1b (M343) (previously called Hg1 and Eu18) is the most frequent Y-chromosome haplogroup in Europe.

Its frequency is highest in Western Europe, especially in Atlantic Europe (and due to European emigration, in North America, South America, and Australia). In southern England, the frequency of R1b is about 70%, and in parts of north and western England, Spain, Portugal, France, Wales, and Ireland, the frequency of R1b is greater than 90%.

Bryan Sykes in his book Blood of the Isles gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in his work The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.

Contents

Subclades

Haplogroup R1b is a descendant of Haplogroup R1 (M173). R1b is characterised by the presence of the M343 marker.

  • R1b (M343)
    • R1b*
    • R1b1 (P25)
      • R1b1*
      • R1b1a (M18)
      • R1b1b (M73)
      • R1b1c (M269, S3, S10, S13, S17)
        • R1b1c*
        • R1b1c1 (M37)
        • R1b1c2 (M65)
        • R1b1c3 (M126)
        • R1b1c4 (M153)
        • R1b1c5 (M160)
        • R1b1c6 (SRY2627 (M167))
        • R1b1c7 (M222)
        • R1b1c8 (P66)
        • R1b1c9 (S21)
          • R1b1c9*
          • R1b1c9a (L1 or S26)
          • R1b1c9b (S29)
        • R1b1c10 (S28)
      • R1b1d (M335)

R1b1c

Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1c subclade.

This subgroup probably originated in Central Asia/South Central Siberia, arriving from West Asia contemporaneous with Aurignacian culture (32,000 - 21,000 BC). Although the precise route of the M269 marker is not known, archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau[1]. It appears to have entered prehistoric Europe mainly from the area of Ukraine/Belarus or Central Asia (Kazakhstan) via the coasts of the Black Sea and the Baltic Sea. It is considered widespread in Europe throughout the Paleolithic already before the last Ice Age.[2] This culture is associated with the Cro-Magnon people, the first modern humans to enter Europe. The Cro-Magnons were the first documented human artists, making sophisticated cave paintings. Famous sites include Lascaux in France, Cueva de las Monedas in Spain and Valley of Foz Côa in Portugal (the largest open-air site in Europe).

European LGM refuges, 20 kya.

The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through founder effects and population bottlenecks, as the population became limited to a few coastal refugia in Southern Europe and Asia Minor. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian peninsula (Portugal and Spain), where the R1b1c haplogroup may have achieved genetic homogeneity. As conditions eased with the Allerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia to Scandinavia, so evident in haplogroup maps.

An alternative belief is that R1b represents the Western or centum-speaking branch of the Proto-Indo-Europeans, although this remains uncertain.

A second R1b1c population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Asia Minor, from where they spread out to repopulate Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1, often thought to be associated with a subsequent migration of Indo-Europeans (or perhaps their ancestors) from the East.

Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~30,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10,000 years bp.

(Note that in earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time (from 2003 to 2005) what is now R1b1c was designated R1b3. This shows how nomenclature can evolve as new markers are discovered and then investigated).

To date the most commonly reported clade is R1b1c*. This implies that the individual is negative (ancestral) for all known subclade markers. R1b1c* is found at highest frequency in Iberia and Ireland with a decreasing cline to the east where the R1b subclade markers S21 and S28 are seen at increasingly higher frequency (beginning in Holland and Eastern France respectively). Until new subclade markers emerge, the most parsimonious interpretation is that R1b1c* reflects Paleolithic hunter - gatherer populations that overwintered in the Franco - Cantabrian Refugium during the last Ice Ages and, while largely remaining in the immediate area, did fan out as far a Central Europe. At this point the only option to obtain information on geographic and possibly tribal data for R1b1c* is to employ haplotype analysis of the Y-STR (short tandem repeat) markers. Various groupings have been identified such as "Southwest Irish" and "Scots (Pictish)" but the modal values for these are no longer available in one spot on the Internet. The clustering analysis of Dr. John McEwan [3]is an excellent starting point. Beyond this, further parsing of R1b1c* into subclades will be dependent on the success of commercial testing companies or academic researchers in locating new Y-SNPs.

The subclades R1b1c4 (M153) and R1b1c6 (SRY2627 (M167)) have been found to be typical of the Basque people; these subclades are only rarely found among Spaniards from other parts of Spain and are found sporadically among other European populations, which at one time was thought to indicate some sort of founder effect or genetic drift among a rather genetically isolated population of proto-Basques. Commercial testing has shown M167 to occur in Southwest England and Ireland, and to a lesser extent in Scotland. This haplogroup has also been reported from France (although a sampling bias may be at "fault" since relatively few French samples have been tested), and as far east as Germany. One problem that is critical to the understanding of the origin of R1b in Europe but which has been overlooked by popularizers of various theories is that the R1b frequency peak found in the Basque Country, Pyrenees, and southwestern France actually overlaps a zone of extremely decreased diversity of R1b-associated STR haplotypes.

The subclade R1b1c7 (M222), on the other hand, is associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as R1b1c7-M222 is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.

The R1b1c9 (S21) subclade, although recently discovered by EthnoAncestry, appears to be the most common downstream marker from R1b1c appearing in over 35% of those tested. This group has a maximum in Frisia (the Netherlands) and, in general, is the predominant R1b haplogroup. It may have originated towards the end of the last ice age, or perhaps more or less 7000 BC, possibly in the northern European mainland.[4] The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al (2007) [5].

The R1b1c9a subclade is defined by the L1/S26 SNP and is downsteam of S21. It occurs in less than a half a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1 was first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry. L1/S26 is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null439". FTDNA displays null alleles at DYS439 with a Blue 12 on public pages, and with a Blue asterisk beside 439 on personal results pages. Other testing companies do report detecting null 439s. For further information, see the null439 project at [6].

The R1b1c9b subclade is defined by S29 and is downsteam of S21. It was discovered by EthnoAncestry, and has to date been found primarily in southern England (although this may reflect a sampling bias). Recent findings show that it also occurs in Germany in the region previously inhabited by the Saxons. Further studies will serve to ascertain whether this is a native Briton marker, or Continental and having arrived in England with the Anglo - Saxons in the 5th Century.

The R1b1c10 (S28) subclade's discovery was announced in 2005 by EthnoAncestry. Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. Ethnoancestry's commercial and research branches have shown that S28 is found from Greece westward to the Bay of Biscay in France. It appears to follow the distribution of the La Tene Celtic peoples. One branch appears to have moved north to Jutland (as the Cimbri / Teutones nation / tribe) and southeastern Norway possibly during the Bronze Age. To date all findings in Britain are only from locations known to be settled by the Norse (e.g., Orkney) and Danes (e.g., English Danelaw) probably during Viking times. The percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both S21 and S28. Like S21, S28's specifications were not initially officially published by EthnoAncestry against their previous assertations that data would be publicly published; but again the marker was subsequently identified independently (as their "U152") by Sims et al (2007). [7]

The newest Y-SNP to surface is S68, which was reported by EthnoAncestry in 2007. It was originally considered to be what was once referred to as a "private SNP" and by EthnoAncestry as a "Family SNP", but was recently seen in someone from another part of Europe, and with a different surname. It is only with continued research that the time depth of these markers can be estimated. At present S68 has been seen in an individual from Scotland and another from Sweden. EthnoAncestry has determined that this subclade (tentatively identified as R1b1c11) is unlikely to be found in much more than 2% of the R1b population and is thus not considered a polymorphism.

Other subclades

Populations characterised as R1b1a (M18), R1b1b (M73), and R1b1d (M335), with those mutually exclusive distinctive markers but no M269 have been found, in Sardinia, Eurasia, and Anatolia respectively. It is presumed that these are descendants of R1b1 populations which found other refuges from the ice.

An apparent R1b1* population has been found among the Ouldeme of Northern Cameroon in west central Africa. [8] [9]

Modal haplotypes

Within the R1b haplogroup are modal haplotypes. One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in the British Isles. In the Iberian Peninsula it reaches 33% in Portugal.

There also exists a haplotype of R1b with the DYS393=12 which is known in the literature as Haplotype 35, or ht35, as opposed to the AMH which is known as haplotype 15. They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the Last Glacial Maximum instead of in Iberia. They can be found in high numbers in the Armenian Highland and Armenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in Uyghur populations in western China, which is thought to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until they were later absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, perhaps through Roman soldiers. For further information and different subgroups of ht35, see [10] .

Niall of the Nine Hostages

In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Dark Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1c7.

Relationship to other haplogroups

Human Y-chromosome DNA (Y-DNA) haplogroups

Y-most recent common ancestor
|
A BR
B CR
C DE F
D E G H IJ K
I J L M NO P
N O Q R
Haplogroup R
Haplogroup R1
Haplogroup R1a

Haplogroup R1a1




Haplogroup R1b




Haplogroup R2



Technical specification of mutation

The technical details of M343 are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5′→ 3′: tttaacctcctccagctctgca
Reverse 5′→ 3′: acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

See also

References

Notes

  1. ^ [1]
  2. ^ [2]

External links

This page uses content from the English language Wikipedia. The original content was at Haplogroup R1b (Y-DNA). The list of authors can be seen in the page history. As with this Familypedia wiki, the content of Wikipedia is available under the Creative Commons License.
Facts about Haplogroup R1b (Y-DNA)RDF feed

This article uses material from the "Haplogroup R1b (Y-DNA)" article on the Genealogy wiki at Wikia and is licensed under the Creative Commons Attribution-Share Alike License.







Got something to say? Make a comment.
Your name
Your email address
Message